Comparison of three amplicon sequencing approaches to determine staphylococcal populations on human skin

BMC Microbiology

Table 1 Primer sets used in this study (without adapter sequences)

Primer pair name	Amplicon position ^a	Target gene		5′ -- > 3’	Amplicon length [bp]	reference
rpsK	2–382	rpsK	fw	TGGCACGTAAACAAGTATC	381	[46]
rpsK	2–382	rpsK	rev	GACGACGTTTTGGTGGAC	381	[46]
tuf1	688–1053	tuf	fw	GGCCGTGTTGAACGTGGTCAAATC	366	[41, 42]
tuf1	688–1053	tuf	rev	TIACCATTTCAGTACCTTCTGGTAA	366	[41, 42]
tuf2	685–1151	tuf	fw	ACAGGCCGTGTTGAACGTG	467	[47]
tuf2	685–1151	tuf	rev	ACAGTACGTCCACCTTCACG	467	[47]

^a Amplicon position in genes (tuf/rpsK) of S. epidermidis ATCC 12228 (GCA_000007645.1)

ISSN: 1471-2180